Omphalitis is an infectious and non-contagious condition of yolk sac accompanied by unhealed navels in chicks. According to Abdel-Tawab et al. (2016), exaggerated chicks appear normal, right up to a few hours before they pass away. Yolk sac infection caused chick mortality during the first week of the post-hatching (Abdel-Tawab et al., 2016). Chicken is the most economical source of animal protein in the comparison with red meat, particularly in developing countries, global broiler production exceeded 100.5 million tons in 2021 and is expected to further increase by 2% in 2022 (Saad et al., 2023). Pathogenic bacteria are the primary causes of poultry diseases worldwide; they are responsible for the most significant economic losses resulting in a huge annual financial loss exceeding 50 billion USD (Rahman et al., 2019; Saad et al., 2023). 

The poultry industry is the important economic sector in Bangladesh and the largest food supplier to the global population. The development of the poultry industry in Bangladesh has increased and is driven by the high market demand for poultry commodities. Many bacterial isolates are responsible for navel illness including Proteus spp., Enterobacter spp., Pseudomonas spp., Klebsiella spp., Staphylococcus spp., Streptococcus spp., Clostridium spp., Bacillus cereus and Enterococcus spp. were isolated from yolk sac in chicks in different locations all over the world (Abdel-Tawab et al., 2016). In previous research several researchers identified Escherichia coli (Eaea) virulence gene, Salmonella invasion (invA) gene and Staphylococcus (MRSA) gene (Abdel-Tawab et al., 2016. All enterprises involved in animal farming, especially chicken farming, are frequently vulnerable to disease. As such, data and understanding regarding the prevalence of diseases as well as initiatives to stop, manage, and completely eradicate them are crucial (Shahen et al., 2019; Wibisono et al., 2022). 

Antimicrobial resistance, especially MDR, is a difficult problem to overcome when treating infectious diseases (Wibisono et al., 2022). The qacED1 gene was found to be present in isolated E. coli with a 100% incidence rate in the previous investigation that looked for disinfectant-resistant genes in unhatched chicken eggs in Egypt (Ibrahim et al., 2019). The study explains why antibiotics fail to treat E. coli infections in poultry and increase the infection rate in the first week of life. Antibiotic resistance is common in poultry farms and the environment and can spread to humans via food or water. Very few researches were conducted to identify disinfectant and antibiotic resistance genes of different bacterial isolates from omphalitis infected chicks in Bangladesh. These antibiotic resistance genes are very harmful for broiler chickens as well as human health. Drug resistance is becoming a growing threat to public health, and the environment, it also induced therapeutic failure and economic losses in animal production. Therefore, the aim of this research was to investigate the incidence, investigate antibiotic and disinfectant resistance isolates from yolk sack of suspected chicken omphalitis, as well as detect specific resistance gene by molecular detection method (PCR).

Study area and yolk swab sampling 

In this study, 24 yolk swab samples were collected from broiler chicks of different hatcheries including 1 to 8 days under Dinajpur District of Bangladesh and aseptically transported with ice box to the bacteriology laboratory, Hajee Mohammad Danesh Science and Technology University for bacterio-logical analysis. The full research period was July - December 2023.

Phenotypic and biochemical characterization of isolates 

According to Azam et al. (2023), bacterial isolates were primarily identified by cultural tests such as Nutrient agar, MacConkey agar, Eosin Methylene agar, Salmonella-Shigella agar, Mannitol salt agar were usually applied for the detection of pure isolates of suspected bacteria from yolk by microscopic (gram staining) and standard biochemical tests such as MR-VP, Indole, Oxidase, Catalase, TSI, Citrate utilization test were used for identification. In this research purpose, all microbiological media were purchased from Hi Media Private Ltd. India.

Molecular identification (DNA extraction and purification) 

According to Riffon et al. (2001), genomic DNA was extracted from selected isolates. Forward primer (5 ATCAACCGAGATTCCCCCAGT 3) and Re-verse primer (5 TCACTATCGGTCAGTCAGGAG 3) were used for detection of 16s rRNA gene of E. coli which in a fragment with about 232 bp length. According to Rahn et al. (1992) Forward primer- (5 GTGAAATTATCGCCACGTTCGGGCAA 3) and Reverse primer- (5 TCATCGCACCGTCAAAGG-AACC 3) were used for detection of invA gene of Salmonella spp. amplified by PCR techniques and final band measure about 284 bp length. According to Riffon et al., (2001), Forward primer Sau-234 and Reverse primer - 1501 were used to detect DNA fragment of Staphylococcus spp. which result in 1267 bp length. According to manufacturer (Max-well-16, source: Promega-USA) guideline, a robotic DNA extractor was applied to extract DNA from E. coli. The purity of E. coli, Salmonella spp., and Staphylococcus spp., DNA was measured by a Nano-drop spectrophotometer (ND-200, source: Thermo Scientific -USA). 1.5% agar gel electrophoresis was used for visualization of PCR band with specific base pair whereas UV-trans illuminator detects photograph of band.

Table 1: PCR Condition for Escherichia coli (Eco 223 and Eco 455).

Table 2: PCR Condition for Salmonella spp. (invA 139 F and invA 141 R).

Table 3: Condition of PCR for Staphylococcus spp. (Sau-234 F and Sau-1501 R).

Evaluating the Antibiotic Susceptibility 

According to Clinical and Laboratory Standards Institute (CLSI) procedure, agar disc diffusion techniques were used to determine the antibiotic sensitivity patterns of isolates on Muller-Hinton agar (CLSI, 2021). A total of 12 commercially available antibiotic discs (Oxoid Limited, UK) such as, Amoxicillin (30 µg), Ampicillin (30 µg), Gentamicin (10 µg), Tetracycline (30 µg), Levofloxacin (5 µg), Co-trimoxazole (30 µg), Cefotaxime (30 µg), Ceftazidime (30 µg), Methicillin (5 µg), Amikacin (30 µg), Azithromycin (30 µg) and Vancomycin (30 µg) were applied for antimicrobial sensitivity test. A pure bacterial colony (0.1 ml) were spread on the Mueller-Hinton agar plate and antibiotic discs were placed on the plates. Then the plates were incubated at 37°C for 16 to 18 hours in standard incubator (BIOBASE, china). After overnight incubation the zones of inhibition was measured by millimeters scale according to (CLSI, 2021) guidelines. All tests were done 3 times for result accuracy.

A. Multidrug Resistance (MDR) Strains Identification

Multidrug resistance bacterial isolates were deter-mined by using disc diffusion method according to (Ezekiel et al., 2011). Multidrug resistance (MDR) was taken as resistant to four or more antibiotics tested.

B. Multiple Antibiotic Resistance (MAR) index determination

According to Saad et al., (2023) the Multiple Anti-biotic Resistance (MAR) index for each strain was determined in which,

MAR index = No. of resistance isolates / Total number of tested antibiotics

MAR index = A/B Where, 

A=No. of resistance isolates; 

B=Total number of tested antibiotics;

C. Disinfectant

Four commercially available disinfectants are used such as, Lysol (Reckitt Benckiser, USA), Virocid             (Cid lines, Belgium), FAM 30 (Renata, Bangladesh) and EMSEN (SK+F Eskayef, Bangladesh) were used at 1% concentrations as per recommended dilution. The zone of inhibition was measured in mm on Mueller-Hinton agar with disinfectant against selected isolates.

Statistical Analysis

Statistical analysis was done based on data variables of isolates. Excel version 13 was applied for data analysis as well as standard deviation and standard error measurement.

Frequency of bacterial isolates among chicks based on different categories

The results of incidence of bacteria in chicks are presented in Table 4. From Table 4, out of 24 examined chicks, 17 (70.83%) were found to be positive cases from two different poultry hatcheries with age 1-8 days. The highest number of positive cases were found in day 4, 7 and 8 (100%) followed by 1, 5 and 5 (66.67%) respectively. The positive cases and isolated bacteria were competatively different from two hatcheries with different ages.

Table 4: Incidence of bacteria in chicks from day 1-8 days.

Table 5: Results of Biochemical Tests.

In this current research three bacterial isolates including E. coli, Salmonella spp. and Staphylococcus spp. was isolated from yolk swab samples from suspected omphalitis chicks from different hatcheries in Dinajpur, Bangladesh. From Hatchery 1, 20 isolates were identified including E. coli 6 (30%), Salmonella spp. 4 (20%) and Staphylococcus spp. 10(50%) whereas 8(53.33%) E. coli, 6 (40%) Salmonella spp. and 1 (6.67%) Staphylococcus spp. was found in hatchery 2. Out of 35 bacterial isolates 20 (57.14%) were isolated from hatcheries 1 and 15 (42.86%) were identified from hatchery 2 respectively. The prevalence of bacteria associated with omphalitis is presented in Fig. 1. 

Fig. 1: Prevalence of isolates (E. coli, Salmonella spp. and Staphylococcus spp.) in 1-4 days and 5-8 days old clinically suspected chicks.

Table 6 represents the correlation bacteria and age group of broiler chicks. The bacterial isolates obtained in our study were 14 (40%) E. coli, 10 (28.58%) Salmonella spp. and 11 (31.42%) Staphylococcus spp. from day 1-8 respectively. The highest number of bacteria we isolated from day 5 including 7 (20%), followed by day 3, 4 and 6 including 6 (17.14%) respectively (Table 6). The highest prevalence of isolates is showed in Fig. 2 with standard deviation and standard error value of day 5 omphalitis suspected chicks.

Table 6: Correlation between mortality due to yolk sac infection based on age.

Fig. 2: Prevalence of infection in Day 5 with error bar. 

Molecular detection of isolates by PCR

After confirmation by cultural and biochemical test, E. coli, Salmonella spp., and Staphylococcus spp., were subjected to molecular confirmation. After PCR amplification with specific primers and specific gene E. coli band were detected 232 bp, Salmonella spp., 284 bp and Staphylococcus spp., 1267 bp respectively. The PCR bands are represented in Fig. 3, 4, and 5.

A. Molecular confirmation of isolated E. coli by PCR technique using Eco-223 and Eco-455 primers 

Fig. 3: 16s and 23s RNA genes of E. coli detected by Eco-223 and Eco-455 primers design confirming 232 bp. M: 100 bp DNA Ladder, NC: negative control, Lanes 1-3 field samples. 

B. Molecular confirmation of invA gene of Salmonella spp.

Fig. 4: invA genes of Salmonella spp. detected by invA-139 and invA-141 primers design confirming 284 bp. M: 100 bp DNA Ladder.

C. Molecular confirmation of Sau-234 gene and Sau-1501 gene of Staphylococcus spp. 

Fig. 5:  23S rRNA genes of Staphylococcus aureus detected by Sau – 234 (F) and Sau – 1501 (R) primer design confirming 1267 bp bands, L: Ladder.

Result of antibiotic sensitivity tests

A. Antibiotic sensitivity test by disc diffusion method on Mueller-Hinton agar

Table 7: Antibiotic resistance profile of E. coli.

Table 7 showed that, E. coli was found to be highly resistant to Amoxicillin (100%), followed by Tetra-cycline (83.33%), Ampicillin (66.67%) whereas highly sensitive to Cefotaxime (100%), Gentamicin and Co-trimoxazole (83.33%) respectively. The analysis of Salmonella spp. sensitivity indicates high susceptibility to, Cefotaxime (83.33), Co-trimoxa-zole (83.33) and Ceftazidime (83.33%), followed by Gentamicin (66.67%) respectively. However very high resistance of Salmonella spp. was detected to Amoxicillin (100%) and Ampicillin (100%) and to Tetracycline (66.67%) which is presented in Fig. 6.

Fig. 6: Antibiotic resistance profile of Salmonella spp.

The resistance profile of Staphylococcus spp. was found to be highly resistance to Methicillin, Ampicillin (100%) followed by Gentamicin and Tetracycline (83.33%) whereas highly sensitive to Amikacin (100%) which are mentioned in Table 8 respectively. 

Table 8: Antibiotic resistance profile of Staphylococcus spp.

B. Multidrug resistance and MAR index calculation of isolates

Fig. 7: MAR index calculation of E. coli.

Fig. 7, 8 and 9 represented the MAR index calculation of isolated E. coli, Salmonella spp. and Staphylococcus spp. from different source of poultry hatcheries. In Fig. 7, the MAR Index ranged begin from 0.5 to 1.00 and the average MAR index being 0.77 in six isolates.

In Fig. 8, the MAR Index ranged begin from 0.625 to 1.00 and the average MAR index being 0.79 in six isolate In Fig. 9, the MAR Index ranged begin from 0.5 to 1.00 and the average MAR index being 0.77 in six isolates.

Fig. 8: MAR index calculation of Salmonella spp.

Fig. 9: MAR index calculation of Staphylococcus spp.
C. Disinfectant Resistance Profile of Isolates 

Table 9: Zone of inhibition of disinfectant measured in mm on Mueller-Hinton agar.

Four commercially available disinfectants such as Lysol, Virocid, FAM 30 and EMSEN were used at 1% concentrations as per recommended dilution. The zone of inhibition was measured in mm on Mueller-Hinton agar with disinfectant against selected isolates. Table 9 indicated that 1% virocid demonstrated the largest inhibition zone (36 mm) among E. coli followed by, Salmonella spp. 27 mm and Staphylococcus spp. 24 mm respectively. E. coli showed 28 mm zone with 1% Lysol and Staphylococcus spp. showed 22 mm. In 1 % EMSEN disinfectant, 22 mm zone were measured in E. coli. 

It is important to note that bacterial agents play a significant role in hatcheries because they reduce the hatchability rate and impact the health of newly hatched chicks and their future performance. There is a lack of knowledge on the co-resistance of antibiotics and disinfectants in bacteria and antimicrobial resistance.

In the current study, a bacteriological examination of 24 different yolk swab samples from different hatcheries revealed that the recovered isolates E. coli 14 (40%), Salmonella spp. 10 (28.58%) and Staphylococcus spp. 11(31.42%), respectively. Our findings agree with the results of many scientists (Al-Khalaf et al., 2010; Kirunda et al., 2010; Azmy, 2010) who could identify similar isolates from omphalitis-suspected chicks. Moreover, Saad et al. (2023) identified bacterial isolates that contaminated hatchery chicks, includes E. coli, Salmonella spp., Staphylococcus spp., Proteus spp., Pseudomonas spp. Similarly, Alfifi et al. (2022) recorded the highest prevalence of E. coli, 45.8%, which is more or less similar to our findings. Due to climate and geographic differences, heavy contamination of the eggs, and improper handling and storage of hatching eggs, the isolation rate of bacteria may be different.

 According to the results, Multi drug resistant E. coli was found to be highly resistant to Amoxicillin (100%) whereas highly sensitive to Cefotaxime (100%), Gentamicin, and Co-trimoxazole (83.33%); these results agreed with Ahmed, (2016) and Abdel-Tawab et al., (2016). Salmonella spp. were sensitive to Ceftazidime, Co-trimoxazole, and Cefotaxime (83.33%). In comparison, it is highly resistant to Ampicillin and Amoxicillin (100%), and the findings agreed with Ahmed et al., (2011) and Ashraf et al., (2016) - consequently, Staphylococcus spp. Obtained resistance to Methicillin and Ampicillin (100%) whereas sensitive to Amikacin (83.33%), these results were similar to Eid et al. (2015) who observed in their research that Staphylococcus spp. were sensitive to Ciprofloxacin (73.30%). Similarly, Ahmed, (2016) and Abdel-Tawab et al. (2016) obtained Staphylococcus spp. were sensitive to Gentamicin 80%, whereas our findings were 100% resistant.

According to Adenaike et al. (2016), a MAR index of 0.2 or higher indicates a high-risk source of contamination, and a MAR index of 0.4 or higher is associated with human fecal sources of conta-mination. In this study, 40% of E. coli having a MAR index of 0.77, and 28.58% of Salmonella spp. having a MAR index of 0.79, while Staphylococcus spp. having 0.77. Regarding the molecular detection of virulence genes, PCR techniques were applied to detect and amplify Eco-223, Eco-445 gene, invA gene, and 23S rRNA genes. The PCR band of E. coli was 232 bp, Salmonella spp. 284 bp and Staphylo-coccus spp. 1167 bp was found by earlier researchers by Shahat et al. (2019). According to Naem et al., (2023), several disinfectants were applied to detect disinfectant resistance isolates, including E. coli, Salmonella spp., and Staphylococcus spp. However, our study demonstrated that E. coli was highly sensitive to 1% virocid with an inhibition zone (36 mm), followed by Salmonella spp. 27 mm and Staphylococcus spp. 24 mm, respectively.

Multi-drug resistance bacterial isolates from newly hatched poultry chicks are dangerous to public health and animal health. Therefore, it is most important to remove these bacterial contaminants from poultry hatcheries by improving the level of hygiene in chick production in the hatcherys environment. This study suggests effective dis-infectants instead of commercial resistance anti-biotics to prevent omphalitis in newly hatched chicks.

The occurrence of multi-drug resistance isolates (E. coli, Salmonella spp., Staphylococcus spp.) in broiler chicks with omphalitis may cause alarming issues for humans and animals due to the spread of causal agents from infected chicks. Effective disinfectants and antibiotics will be the best treatment for chicks omphalitis. Antibiotics such as Cefotaxime, Co-trimoxazole, Amikacin and Gentamicin will be the best choice for omphalitis treatment, while disinfectants viroid and Lysol play a crucial role in preventing and controlling the spread of infection in poultry hatcheries. Additionally, poultry farmers should be aware of the use of antibiotics and their activity against pathogens that are responsible for chicks omphalitis. If poultry owners know pathogens and maintain proper hatchery guidelines, the chicks production loss will be reduced. Identifying the specific resistance genes that are responsible for omphalitis is a great challenge for poultry farmers. Therefore, more and more research on chicks omphalitis will be needed in the future for Bang-ladesh to reduce production loss and improve the chicks quality.

The bacteriological analysis for study was supported by Bacteriology laboratory, Department of Micro-biology, Hajee Mohammad Danesh Science & Technology University, Dinajpur, Bangladesh. The author wants to special thanks to the poultry farm owner for giving their support during collection of samples. Before final publication all authors checked the full manuscript and approved for final submission.

The authors have no conflict of interests.